View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_57 (Length: 320)
Name: NF16077_high_57
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 158 - 301
Target Start/End: Original strand, 40549146 - 40549285
Alignment:
| Q |
158 |
atcacatcatgtttcgtaactgactgcatatatatgtgatatactaagcttcaaaatctcaccatgttgaattttttaaacttaatattgacggttttta |
257 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549146 |
atcacatcatgtttcgtaagtgactgcatat----gtgatatactaagcttcaaaatctcaccatgttgaattttttaaacttaatattgacggttttta |
40549241 |
T |
 |
| Q |
258 |
ccaagccttcgacatatcaattgcttgtgatacgttaaatagag |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549242 |
ccaagccttcgacatatcaattgcttgtgatacgttaaatagag |
40549285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 12 - 124
Target Start/End: Original strand, 40549001 - 40549113
Alignment:
| Q |
12 |
acatcatcaatcgattgtaccgtatgtagtacagatgttagaatagaacgaaacatgcaactttacataaaaagtggtgcatattttttggtacataaat |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549001 |
acatcctcaatcgattgtaccgtatgtagtacagatgttagaatagaacgaaacatgcaactttacataaaaagtggtgcatattttttggtacataaat |
40549100 |
T |
 |
| Q |
112 |
tttggtataaatg |
124 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40549101 |
tttggtataaatg |
40549113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University