View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_59 (Length: 316)
Name: NF16077_high_59
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 14 - 300
Target Start/End: Complemental strand, 36223663 - 36223376
Alignment:
| Q |
14 |
ttcttaaagggtaccaagaagtggactcatatattgatttgggcacattacctggaaatttaacagaggttataaaaatttatgagttcattcattattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223663 |
ttcttaaagggtaccaagaagtggactcatatattgatttgggcacattacctggaaatttaacagaggttataaaaatttatgagttcattcattattt |
36223564 |
T |
 |
| Q |
114 |
t-ttcttcttcttatgaacatttggtttgttaaaatggcctaaatggaacctttttattttcaggatgagatgaagcaacttgaaaggaatgagaaggtg |
212 |
Q |
| |
|
| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223563 |
tatttttcttcttatgaacaattggtttgttaaaatggcctaaatggaacctttttattttcaggatgagatgaagcaacttgaaaggaatgagaaggtg |
36223464 |
T |
 |
| Q |
213 |
gcaatttatttatctaacatagggaacatggtgctatttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223463 |
gcaatttatttatctaacatagggaacatggtgctatttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattg |
36223376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University