View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_70 (Length: 293)
Name: NF16077_high_70
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 15 - 276
Target Start/End: Complemental strand, 30957585 - 30957324
Alignment:
| Q |
15 |
cacagaaacgaccggcaatggtgaaaagagacgaagtatcattccggcggaatttctcggcgtttgctgcggctgctgctgcggcggcggaggcggaaag |
114 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957585 |
cacaaaaacgtccggcaatggtgaaaagagacgaggtatcattccggcggaatttctcggcgtttgctgcggctgctgctgcggcggcggaggcggaaag |
30957486 |
T |
 |
| Q |
115 |
tgtggagtcggaggaatggaggtcgagtaatggaaagaaaggaagagaaaacgatgggacccataaggagtttggtttcagagagcttgctcaggctata |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957485 |
tgtggagtcggaggaatggaggtcgagtactggaaagaaaggaagagaaaacgatgggacccataaggagtttggtttcagagagcttgctcaggctata |
30957386 |
T |
 |
| Q |
215 |
gagagattcagtgaagtatatgaaagagttgaagcttcaaaacagagacaaatggtggaatt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957385 |
gagagattcagtgaagtatatgaaagagttgaagcttcaaaacagagacaaatggtggaatt |
30957324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University