View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_88 (Length: 261)
Name: NF16077_high_88
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 24624400 - 24624152
Alignment:
| Q |
1 |
ctcccggatcacatcattatttagaagcttgggaagatctaccaacttatcccaattcctggtgtggattatttg--ctatgcccatatacggtcctttt |
98 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24624400 |
ctcccggattacatcattatttagaagcttgggaagatctaccaacttatcccaattcctggtgtagattatttgtgctatgcccatacacggtcctttt |
24624301 |
T |
|
| Q |
99 |
tctttgattcagaattccttctccacccacatttcccgctccaccaactctctgcattgttcttgttggtaagtaccttcgaattttaaaggataaaatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24624300 |
tctttgattcagaattccttctccacccacatttcccgctccaccaacgttctgcattgttcttgttggtaagtacctttgaattttaaaggataaaatg |
24624201 |
T |
|
| Q |
199 |
gttcttgtgcacgtgcccttgaagaactagctgcattaattcttttcac |
247 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24624200 |
gttcttgtgcgcgtgcccttgaagaactagctgcattaattcttttcac |
24624152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University