View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_93 (Length: 254)
Name: NF16077_high_93
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 39 - 239
Target Start/End: Complemental strand, 47332197 - 47331997
Alignment:
| Q |
39 |
cctagcgaaaaattacattaccaactcgtccaaaacacggaaatgataaaagtatggtcttaatttaaaacattatcataatttgaatttagttttgata |
138 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47332197 |
cctagccaaaaattacattacctactcgtccaaaacacggaattgataaaagtatggtcttaatttaaaacattatcataatttgaatttagttttgata |
47332098 |
T |
 |
| Q |
139 |
acaccgtattcgctcctaatatttctacatgcatccttattgctagtatggatctcgcaatgggaatatgatatgttttaattcatgatctttgtaattg |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47332097 |
acaccgtattcgctcctaatatttctatatgcatccttattgctagtatggatctcgcaatggaaatatgatatgttttaattcatgatctttgtaattg |
47331998 |
T |
 |
| Q |
239 |
t |
239 |
Q |
| |
|
| |
|
|
| T |
47331997 |
t |
47331997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University