View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_94 (Length: 253)
Name: NF16077_high_94
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_94 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 40364729 - 40364953
Alignment:
| Q |
14 |
agggggtatatcgtaaaatcagtttagcgtgtttatgtctaaggcgtcaatgatggtgtgtgaggtgtatggttcatgcatgaggcgcctgccacggata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40364729 |
agggggtatatcgtaaaatcagtttagcgtgtttatgtctaaggcgccaatgatggtgtgtgaggtgtatggttcatgcatgaggcgcctgccacggata |
40364828 |
T |
 |
| Q |
114 |
tgggttataaaaactgaattttttggtaaatgtgagtttgttcatcaccaaaagagataattatttgaaaaacttaagggcttagaattgaaaactttta |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40364829 |
tgggtcataaaaactgaattttttggtaaatgtgagtttggtcatcaccaaaagagataattatttggaaaacttaagggcttagaattgaaaactttta |
40364928 |
T |
 |
| Q |
214 |
ggtgatattctaggggttagaaaat |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40364929 |
ggtgatattctaggggttagaaaat |
40364953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University