View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_105 (Length: 245)
Name: NF16077_low_105
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_105 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 235
Target Start/End: Complemental strand, 51652932 - 51652718
Alignment:
| Q |
21 |
taagagttgcaaatgttggcaatccagtagccatggcctcaacaactgtcaaaccgaaagcttcatacacagcaggttgcacgaaagctcccttggtgtc |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51652932 |
taagagttgcaaatgttggtaatccagtagccatggcctcaacaactgtcaaaccgaaagcttcatacacagcaggttgcacgaaagctcccttggtgtc |
51652833 |
T |
 |
| Q |
121 |
acaaatcacacggtacagctctccgtttctgacacggttcatctgagaggaaatccatctgaattggccattcaacttgtaggtctcgattaggccatac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51652832 |
acaaatcacacggtacagctctccgtttctgacacggttcatctgagaggaaatccatctgaattggccattcaacttgtaggtctcgattaggccatac |
51652733 |
T |
 |
| Q |
221 |
atcttcttcatctca |
235 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
51652732 |
atcttcttcatctca |
51652718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 26 - 234
Target Start/End: Original strand, 19152808 - 19153016
Alignment:
| Q |
26 |
gttgcaaatgttggcaatccagtagccatggcctcaacaactgtcaaaccgaaagcttcatacacagcaggttgcacgaaagctcccttggtgtcacaaa |
125 |
Q |
| |
|
||||| ||||| ||||||||| || ||| || |||||||| |||||||| ||||||||||| | |||||| ||||| ||||||||||| ||||| |||| |
|
|
| T |
19152808 |
gttgcgaatgtcggcaatccacaagtcatagcttcaacaacagtcaaaccaaaagcttcataaatagcaggctgcacaaaagctccctttgtgtcgcaaa |
19152907 |
T |
 |
| Q |
126 |
tcacacggtacagctctccgtttctgacacggttcatctgagaggaaatccatctgaattggccattcaacttgtaggtctcgattaggccatacatctt |
225 |
Q |
| |
|
| |||||||| ||||||||||| | | |||||||| || ||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||| || |
|
|
| T |
19152908 |
tgacacggtaaagctctccgttccgaattcggttcatttgtgaggaaatccatctgaattggccgttcaatttgtaggtctcgattaggccgtacatttt |
19153007 |
T |
 |
| Q |
226 |
cttcatctc |
234 |
Q |
| |
|
||||||||| |
|
|
| T |
19153008 |
cttcatctc |
19153016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University