View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_107 (Length: 240)
Name: NF16077_low_107
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_107 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 6610793 - 6610574
Alignment:
| Q |
1 |
tcgacaacaaacttctcttctaataaggggcaagactatgcactttttgctgagctgttttgtgttattgtggtttgatgttaaacataaacaactttat |
100 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6610793 |
tcgacaacagacttctcttctaatgaggggcaagactatgcactttttgctgagctgttttgtgttattgtggtttgatgttaaacataaacaactttat |
6610694 |
T |
 |
| Q |
101 |
tcaacatgttatatttgaaagacggattcttaaaagcctttcatactattcaaaatcaggatcactcaaatatacatctatatgcttctttgttggtttg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6610693 |
tcaacatgttatatttaaaagacggattcttaaaagcctttcatactattcaaaatcaggatcactcaaatatacatctatatgcttctttgctggtttg |
6610594 |
T |
 |
| Q |
201 |
gttatattttttatttccaaag |
222 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
6610593 |
gttata--ttttatttccaaag |
6610574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University