View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_111 (Length: 234)
Name: NF16077_low_111
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_111 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 34570032 - 34569812
Alignment:
| Q |
14 |
catttcttagtggttaagtgttttctcttgattgtctttgttggattagatggattgggaaggtcaaaagctagcagagcaactgatgcagatactgctg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570032 |
catttcttagtggttaagtgttttctcttgattgtctttgttggattagatggattgggaaggtcaaaagctagcagagcaactgatgcagatactgctg |
34569933 |
T |
|
| Q |
114 |
ctagcatttgctgtgattgcgtttggagctggatatatcacggcttctttccaaacaatgatcctcatatatgctggtggtgttattctcaccacattag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34569932 |
ctagcatttgctgtgattgcgtttggagctggatatatcacggcttctttccaaacaatgatcctcatatatgctggtggtgttattctcaccacattag |
34569833 |
T |
|
| Q |
214 |
tcactattcccaattggccct |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34569832 |
tcactattcccaattggccct |
34569812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 61 - 234
Target Start/End: Original strand, 38637580 - 38637753
Alignment:
| Q |
61 |
agatggattgggaaggtcaaaagctagcagagcaactgatgcagatactgctgctagcatttgctgtgattgcgtttggagctggatatatcacggcttc |
160 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||| | || ||||||||| || |||| |||||||||||| |||| |||||| | |||||| | | |||||| |
|
|
| T |
38637580 |
agatggattggcaagggcaaaacctagcagagaagctaatgcagataatgttgcttgcatttgctgtggttgcatttggaacgggatatcttatggcttc |
38637679 |
T |
|
| Q |
161 |
tttccaaacaatgatcctcatatatgctggtggtgttattctcaccacattagtcactattcccaattggccct |
234 |
Q |
| |
|
|||| | || ||||| ||||||||||||||||||||| ||||||||||| | || ||| | || |||||||||| |
|
|
| T |
38637680 |
tttcaagacgatgatgctcatatatgctggtggtgttgttctcaccacactggtgactgtcccaaattggccct |
38637753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University