View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_113 (Length: 229)
Name: NF16077_low_113
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_113 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 41320202 - 41320003
Alignment:
| Q |
13 |
agcaaaggaaatgcgtggtgtagtatggctagacaacaaggttaaaacccaaaagaacgaaagtcggctcccgccggtgagaatctccggcgacacttca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320202 |
agcaaaggaaatgcgtggtgtagtatggctagacaacaaggttaaaacccaaaagaacgaaagtcggctcccgccggtgagaatctccggcgacacttca |
41320103 |
T |
|
| Q |
113 |
aaattcgcttataaaaacaaacaaggtcaccgttccgcaatccgaatctcacgaatcgtctcggaaacactccggctcggaatgaaagatgtacggtggt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320102 |
aaattcgcttataaaaacaaacaaggtcaccgttccgcaatccgaatctcacgaatcgtatcggaaacactccggctcggaatgaaagatgtacggtggt |
41320003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University