View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_122 (Length: 208)
Name: NF16077_low_122
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_122 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 37604375 - 37604545
Alignment:
| Q |
20 |
agaggtttagttgagtgggttttgattgattttcctttcattggaagttacttgtcttcatctatgtttgagtggggaataatggggtgttgctgatttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37604375 |
agaggtttagttgagtgggttttgattgattttcctttcattggaagttacttgtcttcatctatgtttgagtggggaataatggggtgttgctgatttc |
37604474 |
T |
|
| Q |
120 |
ttgcttttataatgcttatgcactttgctnnnnnnnntcaagtttgtaagatatgttcttatatatataag |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37604475 |
ttgcttttataatgcttatgcactttgctaaaaaaaatcaagtttgtaagatatgttcttatatatataag |
37604545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University