View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_124 (Length: 206)
Name: NF16077_low_124
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_124 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 24623890 - 24623691
Alignment:
| Q |
1 |
ttccctgctatatatcactagtacactatgctagttctaatatgttgcattannnnnnnnc------agttcaacttctgtatatt---tagcacagnnn |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||| |||| | | |
|
|
| T |
24623890 |
ttccctgctatatatcactagtacactatgctagttctaatatgttgcattattttttttctttttcaattcaacttctgtatattagatagcgctgttt |
24623791 |
T |
|
| Q |
92 |
nnnnctctttcaattcggttattaatgtcatcaatcatggcttgtcgtttattctcacttcccgacattgcttatcaagaggtaagtttcaatttctaac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24623790 |
ttttttctttcaattcggttattaatgtcatcaatcatggcttgtcgtttattctcacttcacgacattgcttatcaagaggtaaatttcaatttctaac |
24623691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University