View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_39 (Length: 395)
Name: NF16077_low_39
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 150 - 262
Target Start/End: Complemental strand, 32270620 - 32270508
Alignment:
| Q |
150 |
gagattctttccactttttaaagttgtccctttgtgttgaaacttcttttttaatcattcaagatcaagtacttcttctttttcaaacctttgtttttaa |
249 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
32270620 |
gagactctttccacttcttaaagttgtccctttgtgttgaaacttcttttttaatcattcaagatcaagtacttcttctttttcaatcctttgcttttaa |
32270521 |
T |
|
| Q |
250 |
ttattgaatagtt |
262 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32270520 |
ttattgaatagtt |
32270508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 319 - 388
Target Start/End: Complemental strand, 32270507 - 32270438
Alignment:
| Q |
319 |
atgtctgtcttgattcaataacctgccgaactcaatttaatatgccgaactcaattatgtaacacctttg |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
32270507 |
atgtctgtcttgattcaataacctgccgaactcaatttaatctgctgaactcaattatgtaacacttttg |
32270438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 64 - 120
Target Start/End: Complemental strand, 32270674 - 32270618
Alignment:
| Q |
64 |
agctgtatgattttgaaagagcaaatttgcaaagaaacaaagataaagtgttatgag |
120 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32270674 |
agctgtatgattttgaaagagcaaatatgcaaagaaacaaagataaagtgttatgag |
32270618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 32270744 - 32270692
Alignment:
| Q |
19 |
ataggggtatatcaaacatcttactgtaattatgatgcaggaggtagctgtat |
71 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
32270744 |
ataggcgtatatcaaacatcttattgtaattatgctgcaggaggtagccgtat |
32270692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 12887699 - 12887759
Alignment:
| Q |
136 |
aaatggaaaacatagagattctttccactttttaaagttgtccctttgtgttgaaacttctt |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||| | ||||||||| |||||||| |
|
|
| T |
12887699 |
aaatggaaaacatagagattctttcaacttattaaagttgt-cttttgtgttggaacttctt |
12887759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University