View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_43 (Length: 378)
Name: NF16077_low_43
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 40 - 268
Target Start/End: Complemental strand, 8170003 - 8169775
Alignment:
| Q |
40 |
aaaaacgttctccctctacaatcttcttggctgaaacccatcagatatgtcatcgatccaacttctaaatgaaaacaagtatgattttccacttctccga |
139 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8170003 |
aaaaaagttctccctctacaatcttcttggctgaaacccatcagatatgtcaccgatccaacttctaactgaaaacaagtatgattttccacttctccga |
8169904 |
T |
|
| Q |
140 |
aaatagttcttcgataattcatatacccattgtcattgtcagtccattccctttctttatatccttttcattccttcttcaattgaaaatattccaatcg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8169903 |
aaatagttcttcgataattcatatacccattgtcattgtcagtccattccctttctttatatccttttcattccttcttcagttgaaaatattccaatcg |
8169804 |
T |
|
| Q |
240 |
accaatcctgttctgttgatgtcattttg |
268 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
8169803 |
accaatcatgttctgttgatgtcattttg |
8169775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 309 - 365
Target Start/End: Complemental strand, 8167941 - 8167885
Alignment:
| Q |
309 |
taagttttaccattaaaatataataacaaatatctcttatgttgtacatagcctatg |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8167941 |
taagttttaccattaaaatataataacaaatatctcttatgttgtacatagcctatg |
8167885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 267 - 318
Target Start/End: Complemental strand, 8169709 - 8169658
Alignment:
| Q |
267 |
tgcagcttgctttggttaaagtgaagttatactcaccttagataagttttac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8169709 |
tgcagcttgctttggttaaagtgaagttatactcaccttagataagttttac |
8169658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University