View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_47 (Length: 356)
Name: NF16077_low_47
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_47 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 13 - 356
Target Start/End: Original strand, 54852138 - 54852478
Alignment:
| Q |
13 |
attttcagcacaatttgattggcggtattttgtatcacgtaatcttgtggactnnnnnnntttacagtgtggttgtgcggcttcttgtggactgtgtata |
112 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852138 |
attttcagcacaatttgatttgtggtattttgtatcaagtaatcctgtggactgggggggtttacagtgtggttgtgcggcttcttgtggactgtgtata |
54852237 |
T |
 |
| Q |
113 |
tagtctacaggttttgtgcgctgtttcttggttgggatagcactatttctgcttttgctgtctcggttgggcaatagtcggatagttccgctgtggatat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54852238 |
tagtctacaggttttgtgcgctgtttctt---tgggatagcactatttctgcttttgctgtctcggttgggcaatagtcggatagttccgccgtggatat |
54852334 |
T |
 |
| Q |
213 |
gtatagcatactttgtatttagtggtgatggtatttgatctttgaggttcgaaattttgagttgcagctggggagcattgggagtttttgtcgagtattg |
312 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852335 |
gtgtagcatactttgtatttagtggtgatggtatttgatctttgaggttcgaaattttgagttgcagctggggagcattgggagtttttgtcgagtattg |
54852434 |
T |
 |
| Q |
313 |
gctcatatcttagattattttgtggtattttttggaagtgccat |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852435 |
gctcatatcttagattattttgtggtattttttggaagtgccat |
54852478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University