View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_48 (Length: 354)
Name: NF16077_low_48
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 66 - 343
Target Start/End: Original strand, 40953647 - 40953924
Alignment:
| Q |
66 |
ttctataactctcttttttattgaaaaatgtttgtcgttagtaatagtatgttaggtacgtgttttgaaccatggacctcgttctcacatccactgtgat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953647 |
ttctataactctcttttttattgaaaaatgtttgtagttagtaatagtatgttaggtacgtgttttgaaccatggacctcgttctcacatccactgtgat |
40953746 |
T |
|
| Q |
166 |
gtaccataatcagtgattcatatttcaatataagnnnnnnnnnnnnnnnngtaagaacgttgtattaaaatttgaatcgtctgatatcgatccaacaaca |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953747 |
gtaccataatcagtgattcatatttcaatataagtttttatttttattttgtaaaaacgttgtattaaaatttgaatcgtctgatatcgatccaacaaca |
40953846 |
T |
|
| Q |
266 |
atagatgttgtgaccgtatgaatgcagtaaatgttgatggcaataatccaatctccgtagactacgccttcttctcac |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
40953847 |
atagatgttgtgaccgtatgaatgcagtaaatgttgatggcaacaatccaatctccgtagactacgccttcttatcac |
40953924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 40953622 - 40953657
Alignment:
| Q |
18 |
acaatattcatattattatttgttcttctataactc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953622 |
acaatattcatattattatttgttcttctataactc |
40953657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University