View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_79 (Length: 286)
Name: NF16077_low_79
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_79 |
 | |
|
| [»] scaffold0036 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 248; Significance: 1e-138; HSPs: 3)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 267
Target Start/End: Complemental strand, 22545 - 22294
Alignment:
| Q |
16 |
aagtgtgagtatttttacacttatggtgataaatcttacaccattggagatttgggtactgattccatcaactttggagaaaaagatgttacatttccta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22545 |
aagtgtgagtatttttacacttatggtgataaatcttacaccattggagatttgggtactgattccatcaactttggagaaaaagatgttacatttccta |
22446 |
T |
|
| Q |
116 |
aatcaatttttggatgtggacatcgaaatgatgtcacatttaaaagaagccgaaaagctacgggtcttgttggtcttggagcaggaccactatcactagt |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22445 |
aatcaatttttggatgtggacatcaaaatgatgtcacatttaaaagaagccgaaaagctacgggtcttgttggtcttggagcaggaccactatcactagt |
22346 |
T |
|
| Q |
216 |
ttcacaactaggtgactcaattggtcacaaattctcctattgtttggttcct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22345 |
ttcacaactaggtgactcaattggtcacaaattctcctattgtttggttcct |
22294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 91 - 268
Target Start/End: Complemental strand, 14432 - 14255
Alignment:
| Q |
91 |
ggagaaaaagatgttacatttcctaaatcaatttttggatgtggacatcgaaatgatgtcacatttaaaagaagccgaaaagctacgggtcttgttggtc |
190 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||| || ||||||| | | | ||| || | ||| | || ||| ||||||||| |
|
|
| T |
14432 |
ggagaaaaagatgttacatttccaaaatcagtttttggatgtggacttcaaaatgatctagggtctgaaactagtcataaaaccacaggtattgttggtc |
14333 |
T |
|
| Q |
191 |
ttggagcaggaccactatcactagtttcacaactaggtgactcaattggtcacaaattctcctattgtttggttcctt |
268 |
Q |
| |
|
| ||| ||| ||| | || ||||||||||||||||| || || ||||||| |||||||| |||||||||||||||| |
|
|
| T |
14332 |
taggactagggccattgtccctagtttcacaactaggcgattctattggtcgaaaattctcttattgtttggttcctt |
14255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 181 - 268
Target Start/End: Original strand, 41298 - 41385
Alignment:
| Q |
181 |
cttgttggtcttggagcaggaccactatcactagtttcacaactaggtgactcaattggtcacaaattctcctattgtttggttcctt |
268 |
Q |
| |
|
||||||||| | |||||||||||| | ||||||||||| ||||||||| | || || |||| |||||||| |||||||||||||||| |
|
|
| T |
41298 |
cttgttggtttaggagcaggaccattgtcactagtttcgcaactaggtcattctatcggtcgaaaattctcgtattgtttggttcctt |
41385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 181 - 268
Target Start/End: Complemental strand, 26464555 - 26464468
Alignment:
| Q |
181 |
cttgttggtcttggagcaggaccactatcactagtttcacaactaggtgactcaattggtcacaaattctcctattgtttggttcctt |
268 |
Q |
| |
|
||||||||||| |||||||||||| | ||||||||||||||||||||| | || || |||| |||||||| |||||||||||||||| |
|
|
| T |
26464555 |
cttgttggtctaggagcaggaccattttcactagtttcacaactaggtcattccatcggtcgaaaattctcttattgtttggttcctt |
26464468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University