View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_81 (Length: 282)
Name: NF16077_low_81
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 34569754 - 34569525
Alignment:
| Q |
18 |
agccagaaccatcttcgaatgtagctgcaaagaaaaaatccattaaaaagtaggtttannnnnnngttgcttatgttggtacttagtgatttaaagtttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34569754 |
agccagaaccatcttcgaatgtagctgcaaagaaaaaatccattaaaaagtaggtttatttttttgttgcttatgttggtacttagtgatttaaagtttg |
34569655 |
T |
 |
| Q |
118 |
aagttgatgctttgaaagaaatttgcatttccttctgcacaatacaatgtacttaacttcttagagtacaattatataattgttttctttttgacattgc |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34569654 |
aagttgatgcttcgaaagaaatttgcatttccttctgcacaatacaatgtacttaacttcttagagtacaattatataattgttttcttttcgacattgc |
34569555 |
T |
 |
| Q |
218 |
ttgtctcgattggcatttacctttatgctt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34569554 |
ttgtctcgattggcatttacctttatgctt |
34569525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University