View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_86 (Length: 270)
Name: NF16077_low_86
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 13 - 254
Target Start/End: Complemental strand, 11307824 - 11307592
Alignment:
| Q |
13 |
aaaatcaactactatgaagtagccagt--acaatgagaacacttctcaatccacatagtatcagcacaaattaaagcaaacttagctaaattgtgttcca |
110 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11307824 |
aaaatcaactgctatgaagcagccagtgtacaatgagaacacttctcaatccacatagtatcagcacaaattaaagcaaacttagctaaattgtgttcca |
11307725 |
T |
 |
| Q |
111 |
cattgcaagttattttctttggcatgtaaagggtaatttgtaatcatgtttgctttaattttgctttaattgtaaacttgtttcattttctcaacaaaac |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11307724 |
cattgcaagttattttctttgccatgtaaagggtaatttgtaatcatgtttgcttt-----------aattgtaaacttgtttcattttctcaacaaaac |
11307636 |
T |
 |
| Q |
211 |
aaatcaacctaaataatgatgacctcaattgtggataatgttgg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11307635 |
aaatcaacctaaataatgatgacctcaattgtggataatgttgg |
11307592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University