View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_low_97 (Length: 255)
Name: NF16077_low_97
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_low_97 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 50502649 - 50502425
Alignment:
| Q |
19 |
actacagacgcgtctttgatttaggtaaattcattgcttcacatgttgatacgagtttagatttccattgttgtgtatactctgcttagatacgctgttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
50502649 |
actacagacgcgtctttgatttaggtaaattcattgcttcacatgttgatacgagtttagatttccattgttgtgtatactttgcttagacacgctgttt |
50502550 |
T |
 |
| Q |
119 |
caaatttttgttattgcagcgtgtattgatcacagaggaacacctgaaaaccctgcaagaacttgcactttggaggagaaagaaggggaaatttgcgtaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50502549 |
caaatttttgttattgcagcgtgtattgatcacagaggaacacctgaaaaccctgcaagaacttgcactttggaggagaaagaaggggaaatttgcgtaa |
50502450 |
T |
 |
| Q |
219 |
gtttatatttgatttctgtgctgct |
243 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
50502449 |
gtttatatttgatttctgtgatgct |
50502425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University