View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16077_low_99 (Length: 253)

Name: NF16077_low_99
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16077_low_99
NF16077_low_99
[»] chr7 (1 HSPs)
chr7 (14-238)||(40364729-40364953)


Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 40364729 - 40364953
Alignment:
14 agggggtatatcgtaaaatcagtttagcgtgtttatgtctaaggcgtcaatgatggtgtgtgaggtgtatggttcatgcatgaggcgcctgccacggata 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
40364729 agggggtatatcgtaaaatcagtttagcgtgtttatgtctaaggcgccaatgatggtgtgtgaggtgtatggttcatgcatgaggcgcctgccacggata 40364828  T
114 tgggttataaaaactgaattttttggtaaatgtgagtttgttcatcaccaaaagagataattatttgaaaaacttaagggcttagaattgaaaactttta 213  Q
    ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
40364829 tgggtcataaaaactgaattttttggtaaatgtgagtttggtcatcaccaaaagagataattatttggaaaacttaagggcttagaattgaaaactttta 40364928  T
214 ggtgatattctaggggttagaaaat 238  Q
    |||||||||||||||||||||||||    
40364929 ggtgatattctaggggttagaaaat 40364953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University