View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16078_low_11 (Length: 288)
Name: NF16078_low_11
Description: NF16078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16078_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 30855495 - 30855756
Alignment:
| Q |
18 |
tggttaatatatctcatcttaactagttgacacctctttctttgtttctattcgaaccccaccgcaaagaatttaacatacattgaat-----ctcctaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| |||| || |
|
|
| T |
30855495 |
tggttaatatatctcatcttaactagttgatacctcttcctttgattctattcgaaccccaccgcaaagaatttaacatatattgaatttcatctccaaa |
30855594 |
T |
 |
| Q |
113 |
attagacactataagaaaagaactcatacaatacattagaattgattgaggaaattatttaatatgtacatctttgtccacttttgataaatgtttactt |
212 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
30855595 |
attagacgctataagaaaagaactcatgcaatacattagaattgattgaggaaattatttaatatgtacatctatgtccgcttttgataaatgtttactt |
30855694 |
T |
 |
| Q |
213 |
gacctaactttgtatgcgcttccaagtatgatcacatatatagttaaaatagccttcttttt |
274 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30855695 |
gacctaactttatatgcgcttccaagtacgatcacatatatagttaaaatagccttcttttt |
30855756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University