View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16079_high_1 (Length: 236)
Name: NF16079_high_1
Description: NF16079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16079_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 10361745 - 10361831
Alignment:
| Q |
8 |
gagaagcaaaggctgcacctgatggaggtgatgttctgggaaccactttaatgactcttacaattttgtattctttgtctcaatata |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10361745 |
gagaagcaatggctgcacctgatggaggtgatgttctgggaaccactttaatgactcttacaattttgtattctttgtctcaatata |
10361831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 218
Target Start/End: Original strand, 36473888 - 36473947
Alignment:
| Q |
159 |
tgatacggtgggaaaagccagcaaccggtcgctataaatgcaacattgatgtctcgttct |
218 |
Q |
| |
|
||||||||||||||||||||| |||||| || | |||||||||||||||| |||||||| |
|
|
| T |
36473888 |
tgatacggtgggaaaagccagtaaccgggcgttgcaaatgcaacattgatgcctcgttct |
36473947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University