View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1607_high_11 (Length: 238)

Name: NF1607_high_11
Description: NF1607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1607_high_11
NF1607_high_11
[»] chr4 (2 HSPs)
chr4 (110-222)||(39194548-39194660)
chr4 (1-44)||(39194409-39194452)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 110 - 222
Target Start/End: Original strand, 39194548 - 39194660
Alignment:
110 gaagaaaggacatttcgttgcaattatattcatgattatgaaatgaattaaattagattataggagtacatctatatcggtttctttttggtcaagtatt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39194548 gaagaaaggacatttcgttgcaattatattcatgattatgaaatgaattaaattagattataggagtacatctatatcggtttctttttggtcaagtatt 39194647  T
210 tataaactatact 222  Q
    |||||||||||||    
39194648 tataaactatact 39194660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 39194409 - 39194452
Alignment:
1 ttttttcgcttaaaatgactttctttttggtataccaacttaga 44  Q
    |||||||||||||||||||||||||| |||||||||||||||||    
39194409 ttttttcgcttaaaatgactttctttgtggtataccaacttaga 39194452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University