View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1607_high_3 (Length: 444)
Name: NF1607_high_3
Description: NF1607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1607_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 7 - 431
Target Start/End: Original strand, 6878654 - 6879077
Alignment:
| Q |
7 |
gaagcaaaggggacggagggcgaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatgg |
106 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878654 |
gaagctaaggggacggtgggcgaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatgg |
6878753 |
T |
|
| Q |
107 |
ctgtctccggtggcgcatgacacagtccggtggcatggggaaaggcatttggagaagacaagatttgagacaaagcctacggcaatgcttctgcagacat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6878754 |
ctgtctccggtggcgcatgacacagtccggtggcatggggaaaggcatttggagaagacaagattcgagacaaagcctacggcaatgcttctgcagacat |
6878853 |
T |
|
| Q |
207 |
tgcattactctgatttggagaaggcagagactgccatagtggaagtgttggttggtttgagttgtgtatattggtgtgagagaagattatagtgagnnnn |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878854 |
tgcattactctgatttggagaaggcagagactgccatagtggaagtgttggttggtttgagttgtgtatattggtgtgagagaagattatagtgagatat |
6878953 |
T |
|
| Q |
307 |
nnnnnnnnnnnnnnnnnnattaggagtaattgcaaggtttcaaaaattaatttatgttgttaagtttataatgattgggctgtgattgttgcagtgtgat |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
6878954 |
attatattataatatataattaggagtaattgcaaggtttcaaaaattaatttatgttgttaagtttatgatgattgggctgt-attgttgcagtgtgat |
6879052 |
T |
|
| Q |
407 |
tgatagttgaagcaatatatatatt |
431 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
6879053 |
tgatagttgaagcaatatatctatt |
6879077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University