View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1607_low_11 (Length: 238)
Name: NF1607_low_11
Description: NF1607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1607_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 110 - 222
Target Start/End: Original strand, 39194548 - 39194660
Alignment:
| Q |
110 |
gaagaaaggacatttcgttgcaattatattcatgattatgaaatgaattaaattagattataggagtacatctatatcggtttctttttggtcaagtatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39194548 |
gaagaaaggacatttcgttgcaattatattcatgattatgaaatgaattaaattagattataggagtacatctatatcggtttctttttggtcaagtatt |
39194647 |
T |
 |
| Q |
210 |
tataaactatact |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39194648 |
tataaactatact |
39194660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 39194409 - 39194452
Alignment:
| Q |
1 |
ttttttcgcttaaaatgactttctttttggtataccaacttaga |
44 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39194409 |
ttttttcgcttaaaatgactttctttgtggtataccaacttaga |
39194452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University