View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1607_low_6 (Length: 285)
Name: NF1607_low_6
Description: NF1607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1607_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 276
Target Start/End: Complemental strand, 49661664 - 49661403
Alignment:
| Q |
17 |
cataccaccacaaaacagtggatgttatatctttttcatagccaaactttgtaaggtttgtatggatgatgaatttgagaacaattatatgatagtttgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49661664 |
cataccaccacaaaacagtggatgttatatctttttcatagccaaactttgtaaggtttgtatggatgatgaatttgagaacaattatatgatagtttgt |
49661565 |
T |
|
| Q |
117 |
gtgtgataagagtgacacaca--tatacagcatatatagagatattctttacatgctactctcttctcttgccgtcacataatattataatactcattcc |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49661564 |
gtgtgataagagtgacacacacatatacagcatatatagagatattctttacatgctactctcttctcttgccgtcacataatattataatactcattcc |
49661465 |
T |
|
| Q |
215 |
aaatcatgctttctactttggatttggaatcaaactcaataaccaccctttccctttgcttc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49661464 |
aaatcatgctttctactttggatttggaatcaaactcaataaccaccctttccttttgcttc |
49661403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University