View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1608-INSERTION-2 (Length: 158)
Name: NF1608-INSERTION-2
Description: NF1608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1608-INSERTION-2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 8 - 158
Target Start/End: Original strand, 24725412 - 24725562
Alignment:
| Q |
8 |
actactattctcactctattcaccatcactttttatattcacattctatatcgataccattcccgataatggaatcctttaattaaagttacaagttacg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24725412 |
actactattctcactctattcaccatcactttttatattcacattctatatcgataccattaccgataatggaatcctttaattaaagttacaagttacg |
24725511 |
T |
|
| Q |
108 |
agattgaaaactttgtnnnnnnnntaacttacgagattgaaaatactttat |
158 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24725512 |
agattgaaaactttgtaaaaaatataacttacgagattgaaaatactttat |
24725562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 31 - 68
Target Start/End: Complemental strand, 8837862 - 8837825
Alignment:
| Q |
31 |
catcactttttatattcacattctatatcgataccatt |
68 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
8837862 |
catcacttttcatattcacattctatatctataccatt |
8837825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University