View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16080_low_10 (Length: 215)
Name: NF16080_low_10
Description: NF16080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16080_low_10 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 13656813 - 13656599
Alignment:
| Q |
1 |
taaaaagtcacataacattacatagttacccctatttatgattcaccttttattatagtttatgtttgttggtggacctaattcctgtttgcagatttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13656813 |
taaaaagtcacataacattacatagttacccctatttatgattcaccttttattatagtttatgtttgttggtggacataattcctgtttgcagatttta |
13656714 |
T |
 |
| Q |
101 |
ggtctacaatcggtattgtagttgaatataaagcctttgaaagctgaaacatacagctgtacggtaccatattattgtagtggtgtcacatgcagcagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13656713 |
ggtctacaatcggtattgtagttgaatataaagcctttgaaagctgaaacatacagctgtacggtaccatattattgtagtggtgtcacatgcagcagag |
13656614 |
T |
 |
| Q |
201 |
attgatttccctctc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13656613 |
attgatttccctctc |
13656599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 13715455 - 13715241
Alignment:
| Q |
1 |
taaaaagtcacataacattacatagttacccctatttatgattcaccttttattatagtttatgtttgttggtggacctaattcctgtttgcagatttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13715455 |
taaaaagtcacataacattacatagttacccctatttatgattcaccttttattatagtttatgtttgttggtggacataattcctgtttgcagatttta |
13715356 |
T |
 |
| Q |
101 |
ggtctacaatcggtattgtagttgaatataaagcctttgaaagctgaaacatacagctgtacggtaccatattattgtagtggtgtcacatgcagcagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715355 |
ggtctacaatcggtattgtagttgaatataaagcctttgaaagctgaaacatacagctgtacggtaccatattattgtagtggtgtcacatgcagcagag |
13715256 |
T |
 |
| Q |
201 |
attgatttccctctc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13715255 |
attgatttccctctc |
13715241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University