View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16082_low_2 (Length: 273)
Name: NF16082_low_2
Description: NF16082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16082_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 18 - 149
Target Start/End: Original strand, 6370983 - 6371112
Alignment:
| Q |
18 |
ctcaatcaattaactaattcattttactcttggaatacattgaatcaattcannnnnnnnnnnnnnnnactggtgtggacatgtcctgtgtatgtacttt |
117 |
Q |
| |
|
|||||||||||||||| || |||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
6370983 |
ctcaatcaattaactagtttatttaactcttggaatacattgaatcaattcatttacaatttttttt-actggtgtggacatgtc-tgtgtatgtgcttt |
6371080 |
T |
|
| Q |
118 |
attgtttattactaatcaagtttgaattaaga |
149 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
6371081 |
attgtttattactaatcaattttgaattaaga |
6371112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 259
Target Start/End: Original strand, 6371174 - 6371217
Alignment:
| Q |
216 |
gaagatgatgatccacaaacggtgaagacaaggttgagacagtg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371174 |
gaagatgatgatccacaaacggtgaagacaaggttgagacagtg |
6371217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 216 - 259
Target Start/End: Original strand, 33222143 - 33222186
Alignment:
| Q |
216 |
gaagatgatgatccacaaacggtgaagacaaggttgagacagtg |
259 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
33222143 |
gaagatgatgatcaacaaacggtgaagacaaggttgatacagtg |
33222186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University