View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16083_low_10 (Length: 211)
Name: NF16083_low_10
Description: NF16083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16083_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 45074486 - 45074295
Alignment:
| Q |
1 |
ttattttcttgcatgatagtatgtactagactaaaccaaagcttcttgcataggcctgcaacggatgtgtcatggctgcccagatttcgctgcgagattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45074486 |
ttattttcttgcatgatagtatgtactagactaaaccaaagcttcttgcataggcctgcaacggatgtgtcatggctgcccagatttcgctgcgagattt |
45074387 |
T |
 |
| Q |
101 |
aaccttatccaactattctgacaatgctagttaacaaaactatgttccacagctaacaaattcgtggttggattcatggtttggtaagtata |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45074386 |
aaccttatccaactattctgacaatgctagttaacaaaactatgttccacagctaacaaattcgtggttggattcatggtttggtaagtata |
45074295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 124 - 181
Target Start/End: Complemental strand, 8881227 - 8881170
Alignment:
| Q |
124 |
atgctagttaacaaaactatgttccacagctaacaaattcgtggttggattcatggtt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
8881227 |
atgctagttaacaaaactatgttccacagctaccaaattcgtggttggatttatggtt |
8881170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 111
Target Start/End: Complemental strand, 37485313 - 37485237
Alignment:
| Q |
35 |
accaaagcttcttgcataggcctgcaacggatgtgtcatggctgcccagatttcgctgcgagatttaaccttatcca |
111 |
Q |
| |
|
|||||| ||| |||||||||| ||||| | ||||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
37485313 |
accaaaactttttgcataggcgtgcaatgattgtgtcatggctgcctagatttcgctgtgagatttaaccatatcca |
37485237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University