View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16085_low_4 (Length: 329)
Name: NF16085_low_4
Description: NF16085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16085_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 320
Target Start/End: Complemental strand, 34867329 - 34867041
Alignment:
| Q |
18 |
tagaattgattttgacatgttcaaatgttcttgaataaaactgattatgtctctagaatttattctaactttaactagaatttgcagctttttagctttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867329 |
tagaattgattttgacatgttcaaatgttcttgaataaaactgattatgtctctagaattgattctaactttaactagaatttgcagctttttagctttg |
34867230 |
T |
|
| Q |
118 |
aatttagtttccaacctatattacattagagaaccgctagcatcaaacgcttggacacactccaaccaacacgcgcacgtttacattgccacgtcccctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
34867229 |
aatttagtttccaacctatattacattagagaaccgctagcatcaaacgcttgg--------------acacgcgcacatttacattgccacgtcccctt |
34867144 |
T |
|
| Q |
218 |
ttcattgaagagtataacaagcaaccggttgaacagtcagcacacatgtttcttaaatctctctcacgcacatacaaagcacaaacaattatagccaccc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867143 |
ttcattgaagagtataacaagcaaccggttgaacagtcagcacacatgtttcttacatctctctcacgcacatacaaagcacaaacaattatagccaccc |
34867044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 109
Target Start/End: Original strand, 51093203 - 51093291
Alignment:
| Q |
21 |
aattgattttgacatgttcaaatgttcttgaataaaactgattatgtctctagaatttattctaactttaactagaatttgcagctttt |
109 |
Q |
| |
|
|||||||||||||||||| | ||||||| |||||| | ||| || ||||| |||| ||||||||| | |||||||||| ||||||| |
|
|
| T |
51093203 |
aattgattttgacatgttttgacgttcttgcataaaatttattttgcctctataattgattctaactgaagctagaatttggagctttt |
51093291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University