View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16086_high_7 (Length: 250)
Name: NF16086_high_7
Description: NF16086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16086_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 31 - 240
Target Start/End: Complemental strand, 26885997 - 26885788
Alignment:
| Q |
31 |
atctccttcaacgtcctcgtgaaaaaggtctcctggacgatactttggcagatagtcttaaggttggttcgtgtttatttataacttgatgattaggcag |
130 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26885997 |
atctccttcggcgtcctcgtgaaaaaggtctcctggacgatactttggcagatagtcttaaggttggttcgtgtttatttataaattgatgattaggcag |
26885898 |
T |
|
| Q |
131 |
gcattgcatctgcattatagtcaagatgactatgatgttttattcttcttcgtaggttatcgtatacctgtatgacggtggatcatatgtgggagaagta |
230 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
26885897 |
gcattgcatctgcatcatagtcaagatgactatgatgttttattcttcttcgtaggttatcgtatacctgtatgatggtggatcatatgtaggagaagta |
26885798 |
T |
|
| Q |
231 |
tgtgcctatg |
240 |
Q |
| |
|
|||||||||| |
|
|
| T |
26885797 |
tgtgcctatg |
26885788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 240
Target Start/End: Original strand, 26631508 - 26631581
Alignment:
| Q |
167 |
gttttattcttcttcgtaggttatcgtatacctgtatgacggtggatcatatgtgggagaagtatgtgcctatg |
240 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||| ||||||| | |||| ||||| ||||||||| |
|
|
| T |
26631508 |
gttttattcttctttgtaggttaagatattcctgtatgacggtcgatcatacgagggacaagtacgtgcctatg |
26631581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University