View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16086_low_4 (Length: 426)
Name: NF16086_low_4
Description: NF16086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16086_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 391; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 391; E-Value: 0
Query Start/End: Original strand, 4 - 410
Target Start/End: Complemental strand, 52113335 - 52112929
Alignment:
| Q |
4 |
aaaatgcacaaatacaaatcaaccatttttcgcgctaatatgccaccaggcccattcatttcctcaaacccaaacgtcattgttttacttgacggaaaat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52113335 |
aaaatgcacaaatacaaatcaaccatttttcgcgctaatatgccaccaggcccattcatttcctctaacccaaacgtcattgttttacttgacggaaaat |
52113236 |
T |
 |
| Q |
104 |
cattccctgttctcttcgacaattccaaagttgaaaaacgtgacctcttcaccggaactttcatgccgtcaacagaactcactggtggttaccgtatcct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113235 |
cattccctgttctcttcgacaattccaaagttgaaaaacgtgacctcttcaccggaactttcatgccgtcaacagaactcactggtggttaccgtatcct |
52113136 |
T |
 |
| Q |
204 |
ctcttaccttgatccaaccgaaccaaaacacgaccaactcaaacgccttcttttcttcctcctcaagtcacgtagtagccactttatccctgagttccac |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52113135 |
ctcttaccttgatccaaccgaaccaaaacacgaccaactcaaacgccttcttttcttcctcctcaagtcacgtagtagccactttatccctgagtttcac |
52113036 |
T |
 |
| Q |
304 |
tcatcttacacaaacctctttaacactctagaaaaagagcttgcaaaaacaggatatgcaattttcgccgacgcaaacgatcaagcagcttttaactacc |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52113035 |
tcatcttacacaaacctctttaacactctagaaaaagagcttgcaaaaacaggaaatgcaattttcgccgatgcaaacgatcaagcagcttttaactacc |
52112936 |
T |
 |
| Q |
404 |
ttgcaaa |
410 |
Q |
| |
|
||||||| |
|
|
| T |
52112935 |
ttgcaaa |
52112929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 76
Target Start/End: Original strand, 12505202 - 12505235
Alignment:
| Q |
43 |
atgccaccaggcccattcatttcctcaaacccaa |
76 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
12505202 |
atgccaccaggtccattcatttcctcaaacccaa |
12505235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University