View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16087_high_12 (Length: 226)

Name: NF16087_high_12
Description: NF16087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16087_high_12
NF16087_high_12
[»] chr8 (1 HSPs)
chr8 (12-209)||(40150408-40150605)


Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 209
Target Start/End: Complemental strand, 40150605 - 40150408
Alignment:
12 gcataggaatattcatacttctgctgtcatgggagttgctggtgttcagcacaaggaaattgtgctgtctgttggtcaagacaagagaattttggggtac 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
40150605 gcataggaatattcatacttctgctgtcatgggagttgctggtgttcagcacaagaaaattgtgctgtctgttggtcaagacaagagaattttggggtac 40150506  T
112 aatgctcacgtgggaagacaagatttcatacatcaagttgatagtaaatgcttgagtatattgccaaatccagttgacttcaatttgttcatggttca 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40150505 aatgctcacgtgggaagacaagatttcatacatcaagttgatagtaaatgcttgagtatattgccaaatccagttgacttcaatttgttcatggttca 40150408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University