View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16087_high_3 (Length: 427)
Name: NF16087_high_3
Description: NF16087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16087_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 1 - 412
Target Start/End: Original strand, 6945739 - 6946150
Alignment:
| Q |
1 |
gcatgaatcaaagagcacaggttacaacattaatcaatggtgtgtgaatccgacggtgtgtatgggcgatatagtgacctgaagtttcagaccagattga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945739 |
gcatgaatcaaagagcacaggttacaacattaatcaatggtgtgtgaatccgagggtgtgtatgggcgatatagtgacctgaagtttcagaccagattga |
6945838 |
T |
 |
| Q |
101 |
tgcattggtgttttgtctcactgtttctgtattagttgtcttggaggtctcattttagttttctttaatggcagcagattggggtattttgtcttttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945839 |
tgcattggtgttttgtctcactgtttctgtattagttgtcttggaggtctcattttagttttctttaatggcagcagattggggtattttgtcttttgat |
6945938 |
T |
 |
| Q |
201 |
tcgctaacggttaactgtttttcctttgcattgtgaggtttggtgggtcaggtgatctgtggagtttaatcctttggtgaaatagttgattgttggtcaa |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945939 |
tcgctaacagttaactgtttttcctttgcattgtgaggtttggtgggtcaggtgatctgtggagtttaatcctttggtgaaatagttgattgttggtcaa |
6946038 |
T |
 |
| Q |
301 |
tcttctgggatgtagttcatggtgccttttctctggcttgataggagttgtagagatgttacaattttggaaaggctcttggttggatctttggtgttgg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6946039 |
tcttctgggatgtagttcatggtgccttttctctggcttgataggagttgtagagatgttacaattttgaaaaggctcttggttggatctttggtgttgg |
6946138 |
T |
 |
| Q |
401 |
tgaagtataatt |
412 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6946139 |
tgaagtataatt |
6946150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University