View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16087_high_5 (Length: 365)
Name: NF16087_high_5
Description: NF16087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16087_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 257 - 358
Target Start/End: Original strand, 43026176 - 43026277
Alignment:
| Q |
257 |
caaatggtggggcacaatgtgagtaattagtgttgtaagctctaggataagataccagttcaattccctattgataaaaaagtatatggtgtctgatctg |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43026176 |
caaatggtggtgcacaatgtgagtaattagtgttgtatgctctaggataagataccagttcaatttcctattgataaaaaagtatatggtgtctgatctg |
43026275 |
T |
 |
| Q |
357 |
tg |
358 |
Q |
| |
|
|| |
|
|
| T |
43026276 |
tg |
43026277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 43025963 - 43026048
Alignment:
| Q |
1 |
ttgataaaaaccgagaattatcttttgacaataaatatgttgttgaatatcatatcaattacaactttgtcttatttatctcccct |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43025963 |
ttgataaaaaccgagaattatcttttgacaataaatatgttgttgaatatcatatcaattacaactttgtcttatttatctcccct |
43026048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 43026118 - 43026169
Alignment:
| Q |
162 |
acaaatgtt-gacgattgttttgaaacattcatttttataatttataccata |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43026118 |
acaaatgttagacgattgttttgaaacattcatttttataatttataccata |
43026169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University