View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16087_low_11 (Length: 227)
Name: NF16087_low_11
Description: NF16087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16087_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 7 - 106
Target Start/End: Complemental strand, 41711701 - 41711602
Alignment:
| Q |
7 |
gttgttttcagaagaggttcaccacaaccatcataataagtgtgcatagagaatgatgacttgaattgaagcaatgcagaactctcattatgatggcatg |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41711701 |
gttgtttttagaagaggttcaccacaaccatcataataagtgtgcatagtgaatgatgacttgaattgaagcaatgcagaactctcatcatgatggcatg |
41711602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 41711537 - 41711485
Alignment:
| Q |
175 |
caaccaccccatggatgatttattttgcttgatcaaatacatatgacgtggaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41711537 |
caaccaccccatggatgatttattttgcttgatcaaatacatatgacgtggaa |
41711485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 106
Target Start/End: Original strand, 42130958 - 42131003
Alignment:
| Q |
61 |
gatgacttgaattgaagcaatgcagaactctcattatgatggcatg |
106 |
Q |
| |
|
||||||||||| |||||||| ||||| || |||||||||||||||| |
|
|
| T |
42130958 |
gatgacttgaactgaagcaaagcagagctgtcattatgatggcatg |
42131003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 104
Target Start/End: Original strand, 8525200 - 8525252
Alignment:
| Q |
52 |
atagagaatgatgacttgaattgaagcaatgcagaactctcattatgatggca |
104 |
Q |
| |
|
|||| ||| ||||||||||| |||||||| ||||| ||||||| ||||||||| |
|
|
| T |
8525200 |
atagtgaaggatgacttgaaatgaagcaaagcagagctctcataatgatggca |
8525252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University