View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16088_low_4 (Length: 285)
Name: NF16088_low_4
Description: NF16088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16088_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 212
Target Start/End: Complemental strand, 43301188 - 43300988
Alignment:
| Q |
12 |
actgatatgaaagagattaagtttcactcgaataaatcgtaggtcttcaaccaaatccatatgttccgatcataatagaaataaacgaagcataaatttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43301188 |
actgatatgaaagagattaagtttcactcgaataaatcgtaggtcttcaaccaaatccatatgttccgatcataatagaaataaacgaagcataaatttg |
43301089 |
T |
|
| Q |
112 |
tgttgaggaaaagaataagtacctcatcttctatgtctttgattttctgcattaccgtcgacattgttgaagaatgagaagctcggaagcaaaggaaaag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43301088 |
tgttgaggaaaagaataagtacctcatcttctatgtctttgattttctgcattaccgtcgacattgttgaagaatgagaagctcgtaagcaaaggaaaag |
43300989 |
T |
|
| Q |
212 |
a |
212 |
Q |
| |
|
| |
|
|
| T |
43300988 |
a |
43300988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 235 - 285
Target Start/End: Original strand, 43300908 - 43300958
Alignment:
| Q |
235 |
tgaacccgtaacatctcaccaccgctcttaggtttcaaactccaatctcag |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43300908 |
tgaacccgtaacatctcaccaccgctcttaggtttcaaactccagtctcag |
43300958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University