View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16089_high_13 (Length: 246)
Name: NF16089_high_13
Description: NF16089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16089_high_13 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 46 - 246
Target Start/End: Complemental strand, 5034996 - 5034796
Alignment:
| Q |
46 |
ctacaaaaactaatttgcacaatggaaaccgatttgcagggcacacaataggtctattcgcaagtcatatattttcttgtagaacaaatagtggtattca |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5034996 |
ctacaaaaactaatttgcacaatggaaaccgatttgcagggcacacaccaggtctattcgcaagtcatatattttcttgtagaacaaataatggtattca |
5034897 |
T |
|
| Q |
146 |
agtaaggattcgggtgcaactgttcacattaggcatccgcacaacattgaattagatgacttgatttttatatagttttggcagaactggaaggaaaatt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5034896 |
agtaaggattcgggtgcaactgttcacattaggcatccgcacaacattgaattagatgacttgatttttatttagttttggcagaactggaaggaaaatt |
5034797 |
T |
|
| Q |
246 |
t |
246 |
Q |
| |
|
| |
|
|
| T |
5034796 |
t |
5034796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 15 - 102
Target Start/End: Complemental strand, 2533201 - 2533112
Alignment:
| Q |
15 |
gtgatgaatgcaagatttcgattaaaacctgctacaaaaactaatttgcacaatggaaa--ccgatttgcagggcacacaataggtctat |
102 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||| || | | |||||||||||||||||| |||||||| |
|
|
| T |
2533201 |
gtgatgaatgcaggatttcgattaaaacctgctgcaaaaactaatttgcacaaatgagatgctgatttgcagggcacacaacaggtctat |
2533112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 166
Target Start/End: Complemental strand, 2489740 - 2489687
Alignment:
| Q |
112 |
atatattttcttgtagaacaaatagtggtattcaagtaaggattcgggtgcaact |
166 |
Q |
| |
|
||||||||| |||||||||||| || |||| ||||||||||||| |||||||||| |
|
|
| T |
2489740 |
atatatttt-ttgtagaacaaacagaggtagtcaagtaaggatttgggtgcaact |
2489687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 171
Target Start/End: Original strand, 5095577 - 5095638
Alignment:
| Q |
110 |
tcatatattttcttgtagaacaaatagtggtattcaagtaaggattcgggtgcaactgttca |
171 |
Q |
| |
|
|||| |||||||||| ||||||||||| |||| ||||||| |||| |||||||||||||| |
|
|
| T |
5095577 |
tcatgtattttcttgaagaacaaatagaggtagtcaagtacagattttggtgcaactgttca |
5095638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University