View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16089_high_17 (Length: 205)
Name: NF16089_high_17
Description: NF16089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16089_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 11 - 189
Target Start/End: Complemental strand, 32929303 - 32929125
Alignment:
| Q |
11 |
aagcaaagggaatggcggttgtgaattaagaaaagaataaacccaagattgaagaaagaatgaccattggtataaatagaagattggacttgacttatgg |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32929303 |
aagcaaaaggaatggcggttgtgaattaagaaaagaataaacccaagattgaagaaagaatgaccattggtataaatagaagattggacttgacttatgg |
32929204 |
T |
 |
| Q |
111 |
tggatcacgttttacacatacacattttgggttctttagataatatacaaattccagtattcattatgtatttgatttg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32929203 |
tggatcacgttttacacatacacattttgggttctttagataatatacaaattccagtattcattatgtctttgatttg |
32929125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University