View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16089_low_14 (Length: 250)
Name: NF16089_low_14
Description: NF16089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16089_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 5034770 - 5034536
Alignment:
| Q |
1 |
tatatgcttacttgattttattatcaaacttgtgtctagtagatgttcgtttgttactcaatctgt-tttatgtgcttagaatgttaataattattcaaa |
99 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5034770 |
tatattcttacttgattttattatcaaacttgtgtctagtagatgttcgtttgttactcaatcttcctttatgtgcttagaatgttaataattattcaaa |
5034671 |
T |
|
| Q |
100 |
atcttttaccagttttatgtttaacattcaacacatctttttaatttggttgaatctccgaatatctatttcattcattttgatatgaaattagaaactt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
5034670 |
gtcttttaccagttttatgtttaacattcaatacatctttttaatttggttgaatctcctgatatctatttcattcatattgatgtgaaattagaaactt |
5034571 |
T |
|
| Q |
200 |
ctccaagcatggtgaaatagtcattgttcatgact |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5034570 |
ctccaagcatggtgaaatagtcattgttcatgact |
5034536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 151 - 228
Target Start/End: Complemental strand, 2489483 - 2489406
Alignment:
| Q |
151 |
gaatctccgaatatctatttcattcattttgatatgaaattagaaacttctccaagcatggtgaaatagtcattgttc |
228 |
Q |
| |
|
||||||| |||||||||||||||||||||||| | |||||||||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
2489483 |
gaatctctaaatatctatttcattcattttgattttaaattagaaacttctcgaagcctggtgaaatggtcattgttc |
2489406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University