View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16089_low_19 (Length: 214)
Name: NF16089_low_19
Description: NF16089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16089_low_19 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 14762 - 14966
Alignment:
| Q |
1 |
tatttatagcactattgtagaagaatgtagtcggaagttatgttacttgannnnnnnnnnataagttgtcaatgcaattttctagtgtgctgttattatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14762 |
tatttatagcactattgtagaagaatgtagtcggaagttatgttacttgattttttttt-ataagttgtcaatgcaattttctagtgtgctgttattatg |
14860 |
T |
 |
| Q |
101 |
gacactgtctatttccaagtagaacatattttgtcatttgatttttgctaaaactaatggatgtatgcattagcacaggttgaagaaagctgtgattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14861 |
gacactgtctatttccaagtagaacatattttgtcatttgatttttgctaaaactaatggatgtatgcattagcacaggttgaagaaagctgtgattatt |
14960 |
T |
 |
| Q |
201 |
cttctc |
206 |
Q |
| |
|
||||| |
|
|
| T |
14961 |
gttctc |
14966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University