View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16089_low_2 (Length: 461)
Name: NF16089_low_2
Description: NF16089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16089_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 17610162 - 17610365
Alignment:
| Q |
18 |
aattgtcggatttcggtctttgcaaaccacttgaagtctcaaatctatcacctataagtgaaaaggaaatattggatgatgataacttgaacgatacaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17610162 |
aattgtcggatttcggtctttgcaaacctcttgaagtctcaaatctatcacctataagtgaaaaggaaatattggatgatgataacttgaacgatacaat |
17610261 |
T |
|
| Q |
118 |
ggacgttgatggaaattacccaaatagtagaaatggtaggcgttggaaaagtcctctcgaacaacttcaacattggcaaatgaataggaggaagttggta |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17610262 |
ggacgttgatggaaattacccgaatagtagaaatggtaggcgttggaaaagtcctctcgaacaacttcaacattggcaaatgaataggaggaagttggta |
17610361 |
T |
|
| Q |
218 |
agca |
221 |
Q |
| |
|
|||| |
|
|
| T |
17610362 |
agca |
17610365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 278 - 450
Target Start/End: Original strand, 17610421 - 17610593
Alignment:
| Q |
278 |
ggtgcaatcatttcagcacagcttgtgcttctaaacttgtgtaccttctttttcaattagtatatggtctttttcacttataaaagaaacaagtccattt |
377 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
17610421 |
ggtgcaatcatttcagcgcagcttgtgcttctcgacttgtgtaccttctttttcaattagtatatggttttttttgcttataaaaggaacaagtccattt |
17610520 |
T |
|
| Q |
378 |
tgataacatttcatcacttcaaacatgttttcatttgcttgcatgaaaatccttctccagcttgtctattcat |
450 |
Q |
| |
|
||||| ||||| ||||||||||||||| || |||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
17610521 |
tgatagcattttatcacttcaaacatgcttacatttgctcgcatgaaagtccttctccaacttgtctattcat |
17610593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University