View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1608_low_26 (Length: 230)
Name: NF1608_low_26
Description: NF1608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1608_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 214
Target Start/End: Complemental strand, 38511172 - 38510966
Alignment:
| Q |
8 |
atcatcaaaaagcatcagatatagcattgcatggattgcttctatggggttcagtgggattcttaatgcctcttggaatacttacaattagaggatccaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38511172 |
atcatcaaaaagcatcagatatagcattacatggattgcttctatggggttcagtgggattcttaatgcctcttggaatacttacaattcgaggatccaa |
38511073 |
T |
|
| Q |
108 |
taaagcagaacctggatcaagaaggagcagaatactcttctatttccatgttgcttttcaggtcatgtatctcttctattaattcctgtgattaaaaggg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38511072 |
taaagcagaacctggatcaagaaggagcagaatactcttctatttccatgttgcttttcaggtcatgtatctcttctattaattcctgtgattaaaaggg |
38510973 |
T |
|
| Q |
208 |
tcatgct |
214 |
Q |
| |
|
||||||| |
|
|
| T |
38510972 |
tcatgct |
38510966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1714 times since January 2019
Visitors: 8692