View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1608_low_9 (Length: 287)

Name: NF1608_low_9
Description: NF1608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1608_low_9
NF1608_low_9
[»] chr8 (1 HSPs)
chr8 (18-253)||(4675362-4675597)


Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 4675597 - 4675362
Alignment:
18 tcctggaaggctacccgtggagttttacaaggaggtggaagggaagatgggagacgatagagagatagtgtgatgtgaatttgaaagggtgagaaagcct 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4675597 tcctggaaggctacccgtggagttttacaaggaggtggaagggaagatgggagacgatagagagatagtgtgatgtgaatttgaaagggtgagaaagcct 4675498  T
118 cttgggataatggtacaaaatcaaatttttcaggggttcaaaattcaaaaaccaaaggtggtttgtataattttttaaagttcaaggtgtgtctgtcaat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4675497 cttgggataatggtacaaaatcaaatttttcaggggttcaaaattcaaaaaccaaaggtggtttgtataattttttaaagttcaaggtgtgtctgtcaat 4675398  T
218 gggattgggaatcaatgcaaattactttctgtctca 253  Q
    ||||||| ||||||||||||||||||||||||||||    
4675397 gggattgagaatcaatgcaaattactttctgtctca 4675362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University