View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1609-INSERTION-1 (Length: 485)
Name: NF1609-INSERTION-1
Description: NF1609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1609-INSERTION-1 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 339; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 143 - 485
Target Start/End: Original strand, 42144075 - 42144417
Alignment:
| Q |
143 |
taatgatgtgcatacatttgacacaggactatgaggacatacttctccccacagatgagcagtggccctttctgcttcggtttcctatcggatgctttgg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42144075 |
taatgatgtgcatacatttgacacaggactatgaggacatacttctccccacagatgagcagtggccctttctgcttcggtttcctatcggatgctttgg |
42144174 |
T |
|
| Q |
243 |
tatttgtctaggactaagcagccaagcggttctatggcttaacctggcaacaagccctgccacaaggtttctccatatctctccggatatcagttttata |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42144175 |
tatttgtctaggactaagcagccaagcggttctatggcttaacctggcaacaagccctgccacaaggtttctccatatctctccggatatcagtttttta |
42144274 |
T |
|
| Q |
343 |
atatggctgttatccttagcagtgctaatagcagtttctattacctacattctcaaatgcatattctactttgaagcagtcagaagagagtatttccatc |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42144275 |
atatggctgttatccttagcagtgctaatagcagtttctattacctacattctcaaatgcatattctactttgaagcagtcagaagagagtatttccatc |
42144374 |
T |
|
| Q |
443 |
cagttcgaatcaacttcttctttgccccttgggttgtctgcat |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42144375 |
cagttcgaatcaacttcttctttgccccttgggttgtctgcat |
42144417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 42143989 - 42144075
Alignment:
| Q |
8 |
cagtctaagttattgatttcacacccgaaaggaaaaccaagttaaaaggatatcttatatagctgtaattttgaaatactaaaaatt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42143989 |
cagtctaagttattgatttcacacccgaaaggaaaaccaagttaaaaggatatcttatatagctgtaattttgaaatactaaaaatt |
42144075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University