View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16090_high_3 (Length: 252)

Name: NF16090_high_3
Description: NF16090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16090_high_3
NF16090_high_3
[»] chr4 (1 HSPs)
chr4 (1-49)||(6130112-6130160)


Alignment Details
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 6130112 - 6130160
Alignment:
1 ttttcacatattcaaggaccaataccactaagaataaattttaccgggc 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
6130112 ttttcacatattcaaggaccaataccactaagaataaattttaccgggc 6130160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University