View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16090_low_4 (Length: 282)
Name: NF16090_low_4
Description: NF16090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16090_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 33339281 - 33339110
Alignment:
| Q |
18 |
gcctggaggtgggagggggagggggaagccgttggaagaagcagctcaagaagctcctcaagctccggtagtgaataggcatatccgcgttcggcaaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33339281 |
gcctggaggtgggagggggagggggaagccgttggaagaagcagctcaagaagctcctcaagctccggtagtgaataggcatatccgcgttcggcaaact |
33339182 |
T |
|
| Q |
118 |
ccggctgatgctgaatctgataatgttcctaggaggcagccaatgaacagatttgtgagagacgatggtgat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
33339181 |
ccggctgatgctgaatctgataatgttcctaggaggcagccgatgaacagatttgtgagagatgatggtgat |
33339110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 228 - 259
Target Start/End: Complemental strand, 33339071 - 33339040
Alignment:
| Q |
228 |
tgtgtatgctcgtggccgaggagatagaggtc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33339071 |
tgtgtatgctcgtggccgaggagatagaggtc |
33339040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University