View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16090_low_5 (Length: 252)
Name: NF16090_low_5
Description: NF16090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16090_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 6130112 - 6130160
Alignment:
| Q |
1 |
ttttcacatattcaaggaccaataccactaagaataaattttaccgggc |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6130112 |
ttttcacatattcaaggaccaataccactaagaataaattttaccgggc |
6130160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University